Main Program/Method name: Earl Grey
Main Program/Method version (if applicable): v3.2.1
Tutorial Author(s): Tobias Baril
Last Update: 13/11/2023
¶ Description
Here is a tutorial to set up and run Earl Grey. Earl Grey is a fully-automated TE curation and annotation pipeline designed to improve on initial RepeatModeler2 families through a BLAST, Extend, Align, Trim process. Following library generation and genome annotation, the pipeline automatically defragments TE annotations and creates user-friendly summaries and figures.
¶ Objectives
- Set up and run Earl Grey on an input genome in FASTA format.
¶ Prerequisites
¶ hardware
- OS: Linux, MacOS, Windows
- CPU: x84_64 architecture and ARM-based processors
- RAM: The more the better, but at least 8GB
- Storage: At least 30GB, depending on input genome size
¶ software
A terminal environment with an anaconda distribution installed. Alternatively, Earl Grey can be used in any web browser via gitpod.io.
¶ Protocol
- To install Earl Grey, simply create a conda environment with the following commands:
conda create -n earlgrey -c conda-forge -c bioconda earlgrey
-
If you want to use Earl Grey on gitpod:
- Navigate to gitpod.io and log in.
- Click "New Workspace"
- When asked to choose a repository, paste this address:
https://github.com/TobyBaril/EarlGrey - Change from a standard machine to large
- Click "Continue"
- The Earl Grey container will build. You can then upload your genome assembly to
/workspace/and use theearlGreycommand as described below.
-
Once this has successfully installed, you can run Earl Grey on your favourite genome assembly in FASTA format. For the default options (de novo annotation, library curation, and subsequent annotation):
conda activate earlgrey
earlGrey -g [genome.fasta] -s [species_name_to_save_files] -t [integer_threads] -o [output_directory]
# Example
earlGrey -g /home/Toby/genomes/homoSapiens.fasta -s homoSapiensTest -t 16 -o /home/Toby/results/
- Pipeline options include:
-g : path to input genome in Fasta format
-s : identifier to save results
-o : path to output directory
-t : number of threads to use for computation
-r : RepeatMasker species term if you would like to mask the input genome with known repeats prior to de novo curation (e.g lepidoptera)
-l : path to existing TE library in Fasta format to mask the input genome with prior to de novo curation (cannot be used in conjunction with -r)
-i : integer max number of iterations to run through the BLAST, Extend, Align, Trim process (default 10)
-f : number of flanking base pairs to add to consensus sequences in each round of the BLAST, Extend, Align, Trim process (default 1000)
-c : yes|no for clustering of TE consensus sequences to the 80-80-80 rule (default no)
-h : show help
- Make a cup of tea, read a book, and wait for the pipeline to finish. It's as simple as that!
- The run time will be highly dependent on the size of the genome assembly and the TE content.
- After the run, summary files including the curated TE library, summary plots, and TE quantifications at classification and family level, can be found in
[species]EarlGrey/[species]_summaryFiles/.- This directory will contain the following files (NOTE: the below are examples and do not represent annotations from a single real run):
- Pie chart summarising TE content as a proportion of the genome assembly:
- TE landscape plot showing relative TE activity as a function of TE copy divergence from consensus. Recently active elements are shown towards the right hand side, with ancient activity on the left.
- High-level TE quantification table (tab-delimited)
tclassif cov count proportion gen Number_of_Distinct_Classifications DNA 71080 47 0.000953350141874542 74558126 1 LINE 9719430 7288 0.130360438512095 74558126 46 LTR 24131541 24825 0.323660777096248 74558126 146 Other (Simple Repeat, Microsatellite, RNA) 159031 418 0.0021329801127244 74558126 87 Penelope 74993 93 0.00100583268415303 74558126 3 Unclassified 16867511 46883 0.226233033271249 74558126 350- Family-level TE quantification table (tab-delimited)
name coverage copy_number RND-1_FAMILY-0#LTR/Gypsy 2466202 1254 RND-1_FAMILY-166#LTR/Gypsy 1629372 566 RND-1_FAMILY-133#LTR/Gypsy 1422586 1072 RND-1_FAMILY-408#LTR/Gypsy 1416551 1405 RND-1_FAMILY-76#LTR/Gypsy 1308630 387 RND-1_FAMILY-421#LTR/Gypsy 1298115 868 RND-1_FAMILY-77#LINE/Tad1 1036048 276 RND-1_FAMILY-33#LINE/Tad1 880704 480 RND-1_FAMILY-365#LTR/Gypsy 783576 238- TE annotations in BED and GFF3 format:
# BED format NC_045808.1 4964941 4965925 LINE/Penelope 5073 + NC_045808.1 7291353 7291525 LINE/L2 1279 + NC_045808.1 8922477 8923791 DNA/TcMar-Tc1 11957 + # GFF3 format NC_045808.1 RepeatMasker LINE/Penelope 4964942 4965925 5073 + . ID="RND-1_FAMILY-48";Tend="2677";Tstart="1700";shortTE="F";uid="cb016329-11ac-492a-b11c-db2dc50e9d89" NC_045808.1 RepeatMasker LINE/L2 7291354 7291525 1279 + . ID="RND-5_FAMILY-151";Tend="1398";Tstart="1226";shortTE="F";uid="b1ffaec9-e362-4ffe-89c2-5830cea00ab7" NC_045808.1 RepeatMasker DNA/TcMar-Tc1 8922478 8923791 11957 + . ID="RND-1_FAMILY-124";Tend="3292";Tstart="1979";shortTE="F";uid="1e507e68-39f3-45f0-b62b-65bd9b7919c8"- Curated TE library in FASTA format:
>rnd-1_family-31#LINE TGTAACATACACAACACTTCTTTCCTCCTACCACCATCTTGTGTGGTTAG CGCTCATAGGAAGGAATAGCAATTTCTTTGTTTTTACACTTCGAGCAAGT ...
¶ Notes
- A video tutorial explaining each step can be found in the "Tutorials" page on this site.
- We welcome feedback and community contributions to further improve our pipeline. Please make use of the GitHub page for discussions and to post issues!